Skip to main content

Table 1 Characterization of the eight microsatellite loci used to genotype five populations of Pomatoschistus marmoratus from the Mar Menor coastal lagoon and adjacent marine sites (SE Spain)

From: Environmental variables, habitat discontinuity and life history shaping the genetic structure of Pomatoschistus marmoratus

Locus Reference Repeat sequence Primer sequences (5′–3′) and the fluorescent dye to mark the 5′ end of the forward primer Annealing temperature (°C) Alleles Size range (bp)
Pmar03 Berrebi et al. (2006) (AC)8GC(AC)12 F: FAM-AGGTTTCCGCTGTTACTGCGAC
R: GAGATAACAAGCGCAAAGTCC
57 20 314–350
Pmar05 Berrebi et al. (2006) (GT)6GC(GT)16 F: FAM-TCTCCGTGGCTCTCCCCAGTGC
R: CTGATCAGGGCCACAGCATCT
54 18 218–248
Pmar08 Berrebi et al. (2006) (ATCTA)5 F: NED-GTCTGGTCAATACTGAACAGCTC
R: ACAGTCTCCAACGGCCGTTCAG
61 8 232–252
Pmin04 Larmuseau et al. (2007) (GT)7ACA(TG)8 F: FAM-TCTAACAGGCAGCTGAACGA
R: GGCTCAAACACACACGAAAA
57 15 209–231
Pmin09 Larmuseau et al. (2007) (TG)2CG(TG)20 F: HEX-GCCGTGGATGCATTATCAGT
R: GGGATGTGTGAGTGTGCAAG
57 16 196–222
Pmin29 Larmuseau et al. (2007) (CA)9 F: NED-GGGCTCCACTTTGTTAGCAG
R: CGTGGGAATTCCTTGATTGT
55 5 206–210
Pmin35 Larmuseau et al. (2007) (CA)3TA(CA)20 F: HEX-GTGACTGGGAGCGTTTGAGT
R: GCCCTATCTGCCTGACAAAG
55 2 162–168
Pmin38 Larmuseau et al. (2007) (TG)4TA(TG)5 F: FAM-TGAATCCGAAGCCTGGTAAC
R: TCCCTTCTGCTTCCTTTTGA
54 31 194–258
  1. Note: The loci Pmar03, Pmin04 and Pmin09 were amplified by multiplex PCR with an annealing temperature of 57 °C. The loci Pmin29 and Pmin35 were amplified by multiplex PCR with an annealing temperature of 55 °C. The loci Pmar05 and Pmin38, despite amplified using the same annealing temperature (54°), were not used as multiplex PCR